pKB222
(Plasmid
#170012)
-
PurposeEncodes LacI-controlled expression of surface-displayed LL-37 and PvirK-mNeonGreen reporter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSC101*
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namemNeonGreen
-
SpeciesBranchiostoma lanceolatum
- Promoter PvirK
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CGTCTAAGAAACCATTATTATCATGACATTAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLL-37
-
SpeciesH. sapiens (human), Synthetic; Escherichia coli
- Promoter Ptac
-
Tags
/ Fusion Proteins
- Lpp (N terminal on insert)
- OmpA (N terminal on insert)
- Tether (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CGGTATCAGCTCACTCAAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPeptide display fusion protein sequence was obtained from Bryan Davies and was originally published in Tucker et al. 2018 (DOI:10.1016/j.cell.2017.12.009).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Peptide display fusion protein sequence was obtained from Bryan Davies and was originally published in Tucker et al. 2018 (DOI:10.1016/j.cell.2017.12.009).
Tucker AT, Leonard SP, DuBois CD, Knauf GA, Cunningham AL, Wilke CO, Trent MS, Davies BW. Discovery of Next-Generation Antimicrobials through Bacterial Self-Screening of Surface-Displayed Peptide Libraries. Cell. 2018 Jan 25;172(3):618-628.e13. doi: 10.1016/j.cell.2017.12.009. Epub 2018 Jan 4. PMID: 29307492; PMCID: PMC5786472. Please visit https://www.biorxiv.org/content/10.1101/2021.06.01.446581v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKB222 was a gift from Jeffrey Tabor (Addgene plasmid # 170012 ; http://n2t.net/addgene:170012 ; RRID:Addgene_170012) -
For your References section:
High-throughput discovery of peptide activators of a bacterial sensor kinase. Brink KR, Mu AM, Hoang KV, Groszman K, Gunn JS, Tabor JJ. bioRxiv 10.1101/2021.06.01.446581