Skip to main content

miniCGBE1-SpRY (pBM1571)
(Plasmid #170105)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170105 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CMV
  • Backbone manufacturer
    pCMV-ABEmax-P2A-EGFP (Addgene #112101)
  • Backbone size w/o insert (bp) 3399
  • Total vector size (bp) 9195
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rAPOBEC1(R33A)-SpRY-nCas9(D10A)-P2A-EGFP
  • Alt name
    bpNLS-rAPOBEC1(R33A)-SpRY-nCas9(D10A)-bpNLS-P2A-EGFP
  • Species
    R. norvegicus (rat); S. pyogenes
  • Insert Size (bp)
    5796
  • Mutation
    R33A in rAPOBEC1 and SpRY-nCas9 (D10A/A61R/L1111R/D1135L/S1136W/G1218K/E1219Q/N1317R/A1322R/R1333P/R1335Q/T1337R)
  • Promoter CMV
  • Tag / Fusion Protein
    • P2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CMV-F (CGCAAATGGGCGGTAGGCGTG)
  • 3′ sequencing primer BGH-rev (TAGAAGGCACAGTCGAGG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    miniCGBE1-SpRY (pBM1571) was a gift from Keith Joung (Addgene plasmid # 170105 ; http://n2t.net/addgene:170105 ; RRID:Addgene_170105)
  • For your References section:

    CRISPR C-to-G base editors for inducing targeted DNA transversions in human cells. Kurt IC, Zhou R, Iyer S, Garcia SP, Miller BR, Langner LM, Grunewald J, Joung JK. Nat Biotechnol. 2020 Jul 20. pii: 10.1038/s41587-020-0609-x. doi: 10.1038/s41587-020-0609-x. 10.1038/s41587-020-0609-x PubMed 32690971