Skip to main content

pNoROS-CAT
(Plasmid #170152)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170152 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSBtet-GP
  • Backbone manufacturer
    Eric Kowarz; Addgene plasmid # 60495
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7800
  • Vector type
    Mammalian Expression ; genome integration via Sleeping Beauty transposon system
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    catalase
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1581
  • GenBank ID
    12359
  • Entrez Gene
    Cat (a.k.a. 2210418N07, Ca, Cas, Cas-1, Cas1, Cs-, Cs-1)
  • Promoter TRE promoter
  • Tags / Fusion Proteins
    • Nucleolar Localization Sequence (NoLS) (N terminal on insert)
    • FLAG tag (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCGATTAGGCGTGTACGGTG
  • 3′ sequencing primer CTCCCCCTGAACCTGAAACA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    roGFP2
  • Species
    Synthetic
  • Promoter RPBSA
  • Tag / Fusion Protein
    • Nucleolar Localization Sequence (NoLS) (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACGGAACTTCGCCTTTCTCT
  • 3′ sequencing primer GAGCGAGTTTCCTTGTCGTC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Paul Schumacker, roGFP2 (Addgene plasmid # 49436).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNoROS-CAT was a gift from Dimitri Pestov (Addgene plasmid # 170152 ; http://n2t.net/addgene:170152 ; RRID:Addgene_170152)
  • For your References section:

    Effects of Hydrogen Peroxide Stress on the Nucleolar Redox Environment and Pre-rRNA Maturation. Sapio RT, Burns CJ, Pestov DG. Front Mol Biosci. 2021 Apr 26;8:678488. doi: 10.3389/fmolb.2021.678488. eCollection 2021. 10.3389/fmolb.2021.678488 PubMed 33981726