pLV.U6gT28.4.EFS-NS.H2B-RFP
(Plasmid
#170365)
-
PurposePlasmid used for Crispr/cas9 based disruption of mouse Trim28, guide targeting exon 4. Expressing nuclear RFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLV
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-RFP
-
Alt nameH2B-mCherry
-
gRNA/shRNA sequenceGGTCCTTGTGAGCGTTGAGC
-
SpeciesSynthetic
- Promoter EFS-NS
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer aaagtgatgtcgtgtactgg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV.U6gT28.4.EFS-NS.H2B-RFP was a gift from Johan Jakobsson (Addgene plasmid # 170365 ; http://n2t.net/addgene:170365 ; RRID:Addgene_170365) -
For your References section:
Activation of endogenous retroviruses during brain development causes an inflammatory response. Jonsson ME, Garza R, Sharma Y, Petri R, Sodersten E, Johansson JG, Johansson PA, Atacho DA, Pircs K, Madsen S, Yudovich D, Ramakrishnan R, Holmberg J, Larsson J, Jern P, Jakobsson J. EMBO J. 2021 Mar 1:e106423. doi: 10.15252/embj.2020106423. 10.15252/embj.2020106423 PubMed 33644903