Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV.U6gT28.3.hSyn.H2B.RFP
(Plasmid #170370)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 170370 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    H2B RFP
  • Alt name
    H2B-mCherry
  • gRNA/shRNA sequence
    GCACTCCACACAATAGCTAG
  • Promoter human Synapsin

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AGTCGTGTCGTGCCTGAGA
  • 3′ sequencing primer catagttaagaataccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV.U6gT28.3.hSyn.H2B.RFP was a gift from Johan Jakobsson (Addgene plasmid # 170370 ; http://n2t.net/addgene:170370 ; RRID:Addgene_170370)
  • For your References section:

    Activation of endogenous retroviruses during brain development causes an inflammatory response. Jonsson ME, Garza R, Sharma Y, Petri R, Sodersten E, Johansson JG, Johansson PA, Atacho DA, Pircs K, Madsen S, Yudovich D, Ramakrishnan R, Holmberg J, Larsson J, Jern P, Jakobsson J. EMBO J. 2021 Mar 1:e106423. doi: 10.15252/embj.2020106423. 10.15252/embj.2020106423 PubMed 33644903