Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #170390)


Item Catalog # Description Quantity Price (USD)
Plasmid 170390 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 10738
  • Total vector size (bp) 12217
  • Vector type
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    TMPRSS2 (a.k.a. PRSS10)
  • Promoter SFFV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGTCGGGCGTACACAAATC
  • 3′ sequencing primer tagccaggcacaatcagcat
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIP-SFFV-Hygro-2A-TMRPSS2 was a gift from Nir Hacohen (Addgene plasmid # 170390 ; ; RRID:Addgene_170390)
  • For your References section:

    Longitudinal proteomic analysis of severe COVID-19 reveals survival-associated signatures, tissue-specific cell death, and cell-cell interactions. Filbin MR, Mehta A, Schneider AM, Kays KR, Guess JR, Gentili M, Fenyves BG, Charland NC, Gonye ALK, Gushterova I, Khanna HK, LaSalle TJ, Lavin-Parsons KM, Lilley BM, Lodenstein CL, Manakongtreecheep K, Margolin JD, McKaig BN, Rojas-Lopez M, Russo BC, Sharma N, Tantivit J, Thomas MF, Gerszten RE, Heimberg GS, Hoover PJ, Lieb DJ, Lin B, Ngo D, Pelka K, Reyes M, Smillie CS, Waghray A, Wood TE, Zajac AS, Jennings LL, Grundberg I, Bhattacharyya RP, Parry BA, Villani AC, Sade-Feldman M, Hacohen N, Goldberg MB. Cell Rep Med. 2021 May 18;2(5):100287. doi: 10.1016/j.xcrm.2021.100287. Epub 2021 May 3. 10.1016/j.xcrm.2021.100287 PubMed 33969320