Skip to main content
Addgene

pLV.EF1α.mEmerald.CD9.miR9T
(Plasmid #170452)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170452 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLV
  • Backbone size w/o insert (bp) 6681
  • Total vector size (bp) 9305
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CD9
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1431
  • GenBank ID
    NM_001769.4 NM_001330312.2
  • Entrez Gene
    CD9 (a.k.a. BTCC-1, DRAP-27, MIC3, MRP-1, TSPAN-29, TSPAN29)
  • Promoter EF1a
  • Tag / Fusion Protein
    • mEmerald (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PspXI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer cctttcgtcttcactcgaggtgcccgtca
  • 3′ sequencing primer gaattctgcagtcgacaatcaacc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Michael Davidson (Addgene plasmid # 54029)
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV.EF1α.mEmerald.CD9.miR9T was a gift from Tsuneya Ikezu (Addgene plasmid # 170452 ; http://n2t.net/addgene:170452 ; RRID:Addgene_170452)
  • For your References section:

    Plaque associated microglia hyper-secrete extracellular vesicles and accelerate tau propagation in a humanized APP mouse model. Clayton K, Delpech JC, Herron S, Iwahara N, Ericsson M, Saito T, Saido TC, Ikezu S, Ikezu T. Mol Neurodegener. 2021 Mar 22;16(1):18. doi: 10.1186/s13024-021-00440-9. 10.1186/s13024-021-00440-9 PubMed 33752701