pSynapsin_NLS_GFP_P2A_His6_NR1.
(Plasmid
#170457)
-
PurposeExpresses histidine tagged NR1 in neuronal cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepFUGW
- Backbone size w/o insert (bp) 9370
- Total vector size (bp) 12124
-
Modifications to backboneUBC promoter replaced with neuron specific synapsin promoter. Introduced NLS-GFP for checking transfection efficiency.
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNR1
-
Alt nameNMDA receptor subunit 1
-
SpeciesR. norvegicus (rat)
-
Entrez GeneGrin1 (a.k.a. GluN1, NMDAR1, NR1)
- Promoter Synapsin
-
Tag
/ Fusion Protein
- Hexa-histidin (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGCATCGACTTCAAGGAGGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byNR1 was taken from Addgene 23999
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSynapsin_NLS_GFP_P2A_His6_NR1. was a gift from Shigeki Watanabe (Addgene plasmid # 170457 ; http://n2t.net/addgene:170457 ; RRID:Addgene_170457) -
For your References section:
Asynchronous release sites align with NMDA receptors in mouse hippocampal synapses. Li S, Raychaudhuri S, Lee SA, Brockmann MM, Wang J, Kusick G, Prater C, Syed S, Falahati H, Ramos R, Bartol TM, Hosy E, Watanabe S. Nat Commun. 2021 Jan 29;12(1):677. doi: 10.1038/s41467-021-21004-x. 10.1038/s41467-021-21004-x PubMed 33514725