pHR-iRFP670-CaaX
(Plasmid
#170464)
-
PurposeExpresses iRFP670 fluorophore targeted to the plasma membrane using a prenylation motif
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170464 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR-SIN
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiRFP670-CaaX
-
SpeciesSynthetic
-
Insert Size (bp)1002
- Promoter SFFV
-
Tag
/ Fusion Protein
- CaaX (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cttctgttcgcgcgcttctgcttc
- 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-iRFP670-CaaX was a gift from John James (Addgene plasmid # 170464 ; http://n2t.net/addgene:170464 ; RRID:Addgene_170464) -
For your References section:
Quantifying persistence in the T-cell signaling network using an optically controllable antigen receptor. Harris MJ, Fuyal M, James JR. Mol Syst Biol. 2021 May;17(5):e10091. doi: 10.15252/msb.202010091. 10.15252/msb.202010091 PubMed 33988299