pHR-OptoCAR-mScarlet
(Plasmid
#170463)
-
PurposeExpresses an optically-controllable chimeric antigen receptor that is dependent on dimerizer drug, fused to mScarlet fluorophore
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170463 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepHR-SIN
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOptoCAR
-
SpeciesSynthetic
-
Insert Size (bp)3000
- Promoter SFFV
-
Tag
/ Fusion Protein
- mScarlet (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer cttctgttcgcgcgcttctgcttc
- 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-OptoCAR-mScarlet was a gift from John James (Addgene plasmid # 170463 ; http://n2t.net/addgene:170463 ; RRID:Addgene_170463) -
For your References section:
Quantifying persistence in the T-cell signaling network using an optically controllable antigen receptor. Harris MJ, Fuyal M, James JR. Mol Syst Biol. 2021 May;17(5):e10091. doi: 10.15252/msb.202010091. 10.15252/msb.202010091 PubMed 33988299