Skip to main content

pCAG-FLAG-puro-PTPIP51(1-470)
(Plasmid #170536)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170536 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAG_FLAG_puro
  • Backbone size w/o insert (bp) 6034
  • Total vector size (bp) 7444
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Protein tyrosine phosphatase interacting protein 51
  • Alt name
    PTPIP51
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1410
  • Entrez Gene
    RMDN3 (a.k.a. FAM82A2, FAM82C, RMD-3, RMD3, ptpip51)
  • Promoter CAG promoter
  • Tag / Fusion Protein
    • FLAG tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer pCAG-F, GCAACGTGCTGGTTATTGTG
  • 3′ sequencing primer pCAG-R, AAGCGGCTTCGGCCAGTA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-FLAG-puro-PTPIP51(1-470) was a gift from Byung Il Lee (Addgene plasmid # 170536 ; http://n2t.net/addgene:170536 ; RRID:Addgene_170536)
  • For your References section:

    Phospholipid transfer function of PTPIP51 at mitochondria-associated ER membranes. Yeo HK, Park TH, Kim HY, Jang H, Lee J, Hwang GS, Ryu SE, Park SH, Song HK, Ban HS, Yoon HJ, Lee BI. EMBO Rep. 2021 Jun 4;22(6):e51323. doi: 10.15252/embr.202051323. Epub 2021 May 2. 10.15252/embr.202051323 PubMed 33938112