pCAG-FLAG-puro-PTPIP51(1-150_175-470)
(Plasmid
#170537)
-
PurposeExpresses PTPIP51 FFAT-like motif (151-175) deletion mutant (1-150_176-470) in human HeLa cells after transfection
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG_FLAG_puro
- Backbone size w/o insert (bp) 6034
- Total vector size (bp) 7372
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameProtein tyrosine phosphatase interacting protein 51
-
Alt namePTPIP51
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1338
-
Mutationdeleted amino acids 151-175
-
Entrez GeneRMDN3 (a.k.a. FAM82A2, FAM82C, RMD-3, RMD3, ptpip51)
- Promoter CAG promoter
-
Tag
/ Fusion Protein
- FLAG tag (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xhoi (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer pCAG-F, GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer pCAG-R, AAGCGGCTTCGGCCAGTA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that deletion is of amino acids 151-175.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-FLAG-puro-PTPIP51(1-150_175-470) was a gift from Byung Il Lee (Addgene plasmid # 170537 ; http://n2t.net/addgene:170537 ; RRID:Addgene_170537) -
For your References section:
Phospholipid transfer function of PTPIP51 at mitochondria-associated ER membranes. Yeo HK, Park TH, Kim HY, Jang H, Lee J, Hwang GS, Ryu SE, Park SH, Song HK, Ban HS, Yoon HJ, Lee BI. EMBO Rep. 2021 Jun 4;22(6):e51323. doi: 10.15252/embr.202051323. Epub 2021 May 2. 10.15252/embr.202051323 PubMed 33938112