Skip to main content

pLV/Guide-mCherry
(Plasmid #170543)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170543 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLV_Guide-Puro
  • Backbone size w/o insert (bp) 10182
  • Total vector size (bp) 10182
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    713
  • Promoter Ef1-alpha

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAGTTTCCCCACACTGAGT
  • 3′ sequencing primer ACGCCACGTTGCCTGACAAC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    pLV_Guide-Puro was initially cloned based on: lentiGuide-Puro was a gift from Feng Zhang (Addgene plasmid # 52963 ; http://n2t.net/addgene:52963 ; RRID:Addgene_52963) and Human GeCKOv2 CRISPR knockout pooled library was a gift from Feng Zhang (Addgene # )

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV/Guide-mCherry was a gift from Jacob Giehm Mikkelsen (Addgene plasmid # 170543 ; http://n2t.net/addgene:170543 ; RRID:Addgene_170543)
  • For your References section:

    CRISPR-Cas9-directed gene tagging using a single integrase-defective lentiviral vector carrying a transposase-based Cas9 off switch. Thomsen EA, Skipper KA, Andersen S, Haslund D, Skov TW, Mikkelsen JG. Mol Ther Nucleic Acids. 2022 Aug 4;29:563-576. doi: 10.1016/j.omtn.2022.08.005. eCollection 2022 Sep 13. 10.1016/j.omtn.2022.08.005 PubMed 36090759