Skip to main content
Addgene

pCMV-FLuc
(Plasmid #170575)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170575 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    MSCV IRES Luciferase
  • Backbone manufacturer
    from addgene #18760
  • Backbone size w/o insert (bp) 6300
  • Total vector size (bp) 7400
  • Modifications to backbone
    IRES changed to CMV promoter
  • Vector type
    Mammalian Expression, Retroviral, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Luc
  • Alt name
    firefly luciferase
  • Species
    firefly
  • Insert Size (bp)
    1600
  • Promoter CMV
  • Tag / Fusion Protein
    • NA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (destroyed during cloning)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer taagctagcttgccaaacctac
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    modified from addgene #18760
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-FLuc was a gift from David Nemazee (Addgene plasmid # 170575 ; http://n2t.net/addgene:170575 ; RRID:Addgene_170575)
  • For your References section:

    Isolation of potent SARS-CoV-2 neutralizing antibodies and protection from disease in a small animal model. Rogers TF, Zhao F, Huang D, Beutler N, Burns A, He WT, Limbo O, Smith C, Song G, Woehl J, Yang L, Abbott RK, Callaghan S, Garcia E, Hurtado J, Parren M, Peng L, Ramirez S, Ricketts J, Ricciardi MJ, Rawlings SA, Wu NC, Yuan M, Smith DM, Nemazee D, Teijaro JR, Voss JE, Wilson IA, Andrabi R, Briney B, Landais E, Sok D, Jardine JG, Burton DR. Science. 2020 Aug 21;369(6506):956-963. doi: 10.1126/science.abc7520. Epub 2020 Jun 15. 10.1126/science.abc7520 PubMed 32540903