pJCX4
              
              
                (Plasmid
                
                #170756)
              
            
            
            
          - 
            Purpose(Empty Backbone) Express in mammalian cells a target protein C-terminally fused to the Mxe GryA intein - chitin binding domain (CBD) tag.
 - 
              Depositing Lab
 - 
          Sequence Information
 
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepJCX4
 - Backbone size (bp) 5409
 - 
              Modifications to backboneDerived from pEGFP-C1. The Mxe GyrA intein, chitin binding domain (CBD), and Woodchuck hepatitis virus (WHP) posttranscriptional regulatory element (WPRE) were added to facilitate expression of a target protein in mammalian cells with Mxe GyrA intein - CBD tag fused C-terminally.
 - 
              Vector typeMammalian Expression
 - Promoter CMV
 - 
    
        Tag
        / Fusion Protein
    
- Mxe GyrA intein - chitin binding domain (CBD) (C terminal on backbone)
 
 
Growth in Bacteria
- 
            Bacterial Resistance(s)Kanamycin, 50 μg/mL
 - 
            Growth Temperature37°C
 - 
            Growth Strain(s)DH5alpha
 - 
            Copy numberHigh Copy
 
Cloning Information
- Cloning method Restriction Enzyme
 - 5′ sequencing primer CMV for: CGCAAATGGGCGGTAGGCGTG
 - 3′ sequencing primer Mxe rev: GATTGCCATGCCGGTCAAGG (Common Sequencing Primers)
 
Resource Information
- 
            
            
            Supplemental Documents
 - 
            Article Citing this Plasmid
 
Terms and Licenses
- 
        Academic/Nonprofit Terms
 - 
      Industry Terms
- Not Available to Industry
 
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
 
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438513v2 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              
For your Materials & Methods section:
pJCX4 was a gift from Roberto Dominguez (Addgene plasmid # 170756 ; http://n2t.net/addgene:170756 ; RRID:Addgene_170756) - 
                
For your References section:
Novel human cell expression method reveals the role and prevalence of posttranslational modification in nonmuscle tropomyosins. Carman PJ, Barrie KR, Dominguez R. J Biol Chem. 2021 Oct;297(4):101154. doi: 10.1016/j.jbc.2021.101154. Epub 2021 Sep 1. 10.1016/j.jbc.2021.101154 PubMed 34478714