pL1M-pMtRC-MtLAP1-Adh-R1
(Plasmid
#170790)
-
PurposeA Root Tip-Specific Expressing Anthocyanin Marker for Direct Identification of Transgenic Tissues by the Naked Eye in Symbiotic Studies
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170790 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepL1V-R1-47802
- Backbone size w/o insert (bp) 4968
-
Vector typeBacterial Expression, Plant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMtLAP1
-
Alt nameLegume Anthocyanin production 1
-
SpeciesMedicago truncatula
-
Insert Size (bp)975
-
GenBank IDFJ199998
-
Entrez GeneLOC11412013 (a.k.a. MTR_8g060940)
- Promoter Medtr4g059670(MtRC)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site aatgttgtcttcATGATGGAGAATACCGGAGGTGT (destroyed during cloning)
- 3′ cloning site aagcttgtcttcTCAAGGTAGATCCCAAAGAG (destroyed during cloning)
- 5′ sequencing primer acccgccaatatatcctgtc
- 3′ sequencing primer gcaggatatattgtggtgta (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pL1M-pMtRC-MtLAP1-Adh-R1 was a gift from Jeremy Murray (Addgene plasmid # 170790 ; http://n2t.net/addgene:170790 ; RRID:Addgene_170790) -
For your References section:
A Root Tip-Specific Expressing Anthocyanin Marker for Direct Identification of Transgenic Tissues by the Naked Eye in Symbiotic Studies. Ruan Y, Chen K, Su Y, Jiang S, Xu P, Murray JD. Plants (Basel). 2021 Mar 23;10(3). pii: plants10030605. doi: 10.3390/plants10030605. 10.3390/plants10030605 PubMed 33806858