pUASTattB-GFP-Msp300KASH
(Plasmid
#170806)
-
PurposeExpresses Msp300 KASH domain fused to GFP under Gal4/UAS control for Drosophila transgenesis
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170806 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUASTattB
- Backbone size w/o insert (bp) 9360
- Total vector size (bp) 10341
-
Vector typeInsect Expression
-
Selectable markersmini-white
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-Msp300KASH
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)908
- Promoter 5xUAS + hsp70 minimal promoter
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CAACTGCAACTACTGAAATCTGCC
- 3′ sequencing primer ggcattccaccactgctccc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJanice Fischer
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid derived from GFP-Msp300KASH fusion provided by Janice Fischer and described in:
Yu, J. et al. (2006) The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Developmental biology 289, 336-345, doi:10.1016/j.ydbio.2005.10.027
Plasmid first described in:
Ma, J. and Weake, V.M. (2014). Affinity-based isolation of tagged nuclei from Drosophila tissues for gene expression analysis. Journal of Visualized Experiments 85. PMID:24686501.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUASTattB-GFP-Msp300KASH was a gift from Vikki Weake (Addgene plasmid # 170806 ; http://n2t.net/addgene:170806 ; RRID:Addgene_170806) -
For your References section:
In vivo tissue-specific chromatin profiling in Drosophila melanogaster using GFP-tagged nuclei. Jauregui-Lozano J, Bakhle K, Weake VM. Genetics. 2021 May 22. pii: 6281219. doi: 10.1093/genetics/iyab079. 10.1093/genetics/iyab079 PubMed 34022041