pUASTattB-GFP-Msp300KASH
(Plasmid #170806)

• Purpose: Expresses Msp300 KASH domain fused to GFP under Gal4/UAS control for Drosophila transgenesis
• Depositing Lab: Vikki Weake
• Publication: Jauregui-Lozano et al Genetics. 2021 May 22. pii: 6281219. doi: 10.1093/genetics/iyab079.

Backbone

• Vector backbone: pUASTattB
• Backbone size w/o insert (bp): 9360
• Total vector size (bp): 10341
• Vector type: Insect Expression
• Selectable markers: mini-white

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GFP-Msp300KASH
• Species: D. melanogaster (fly)
• Insert Size (bp): 908
• Promoter: 5xUAS + hsp70 minimal promoter
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: CAACTGCAACTACTGAAATCTGCC
• 3′ sequencing primer: ggcattccaccactgctccc

Resource Information

• Supplemental Documents:
  • pUASTattB-GFP-Msp300KASH.gbk
• A portion of this plasmid was derived from a plasmid made by: Janice Fischer
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid derived from GFP-Msp300KASH fusion provided by Janice Fischer and described in:
Yu, J. et al. (2006) The KASH domain protein MSP-300 plays an essential role in nuclear anchoring during Drosophila oogenesis. Developmental biology 289, 336-345, doi:10.1016/j.ydbio.2005.10.027

Plasmid first described in:
Ma, J. and Weake, V.M. (2014). Affinity-based isolation of tagged nuclei from Drosophila tissues for gene expression analysis. Journal of Visualized Experiments 85. PMID:24686501.