Skip to main content

PiggyBac EF1a-eGFP-Puro U6 CLCN3 g1
(Plasmid #170828)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 170828 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PiggyBac EF1a-eGFP-Puro U6 BbsI
  • Backbone size w/o insert (bp) 5575
  • Total vector size (bp) 5580
  • Vector type
    Mammalian Expression ; Piggybac transposon
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas13d CLCN3 gRNA1
  • gRNA/shRNA sequence
    GAAAAGATATTTCCGCAGCAACA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    23
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT
  • 3′ sequencing primer M13 RVS
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PiggyBac EF1a-eGFP-Puro U6 CLCN3 g1 was a gift from Xiaoping Bao (Addgene plasmid # 170828 ; http://n2t.net/addgene:170828 ; RRID:Addgene_170828)
  • For your References section:

    Engineering chimeric antigen receptor neutrophils from human pluripotent stem cells for targeted cancer immunotherapy. Chang Y, Syahirah R, Wang X, Jin G, Torregrosa-Allen S, Elzey BD, Hummel SN, Wang T, Li C, Lian X, Deng Q, Broxmeyer HE, Bao X. Cell Rep. 2022 Jul 19;40(3):111128. doi: 10.1016/j.celrep.2022.111128. 10.1016/j.celrep.2022.111128 PubMed 35858579