pUPD2+E-Luc
(Plasmid
#170873)
-
PurposePhytobrick - E-Luc Luciferase CDS
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 170873 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUPD2
-
Backbone manufacturerDiego Orzaez Lab
- Backbone size w/o insert (bp) 2105
-
Vector typeLuciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE-Luc
-
Alt nameEnhanced beetle luciferase
-
SpeciesPyrearinus termitilluminans
-
Insert Size (bp)1630
-
Mutationc.375C>T to remove BbsI site
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Esp3I (destroyed during cloning)
- 3′ cloning site Esp3I (destroyed during cloning)
- 5′ sequencing primer ATAGGCGTATCACGAGGCAG
- 3′ sequencing primer CGAGTCAGTGAGCGAGGAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal gene from https://doi.org/10.1371/journal.pone.0010011
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.05.26.443018v2 to read the preprint on bioRxiv.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUPD2+E-Luc was a gift from Markita Landry (Addgene plasmid # 170873 ; http://n2t.net/addgene:170873 ; RRID:Addgene_170873) -
For your References section:
A Ratiometric Dual Color Luciferase Reporter for Fast Characterization of Transcriptional Regulatory Elements in Plants. Gonzalez-Grandio E, Demirer GS, Ma W, Brady S, Landry MP. ACS Synth Biol. 2021 Sep 14. doi: 10.1021/acssynbio.1c00248. 10.1021/acssynbio.1c00248 PubMed 34520169