Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

bdSUMO-HA2-GFP-HiBit
(Plasmid #171017)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171017 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET His6 MBP TEV LIC cloning vector (2M-T)
  • Backbone size w/o insert (bp) 4694
  • Total vector size (bp) 5822
  • Vector type
    Bacterial Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    14x-His-bdSUMO-HA2-muGFP-HiBiT
  • Species
    Synthetic; Brachypodium distachyon
  • Promoter T7

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    bdSUMO-HA2-GFP-HiBit was a gift from Angus Johnston (Addgene plasmid # 171017 ; http://n2t.net/addgene:171017 ; RRID:Addgene_171017)
  • For your References section:

    Unravelling cytosolic delivery of cell penetrating peptides with a quantitative endosomal escape assay. Teo SLY, Rennick JJ, Yuen D, Al-Wassiti H, Johnston APR, Pouton CW. Nat Commun. 2021 Jun 17;12(1):3721. doi: 10.1038/s41467-021-23997-x. 10.1038/s41467-021-23997-x PubMed 34140497