pLPC-dnMAML1-mVenus
(Plasmid
#171023)
-
PurposeRetroviral vector for CMV promoter driven expression of dominant negative (DN) MAML1 (Notch pathway) fused to mVenus fluorescent protein (to be used in conjunction with Phoenix packaging cells).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLPC
- Backbone size w/o insert (bp) 5763
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMAML1 Dominant Negative
-
Alt nameaa12-74 MAML1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)189
-
Mutationamino acids 12-74 only, hence conferring dominant negative (DN) properties
-
GenBank IDNM_014757
-
Entrez GeneMAML1 (a.k.a. Mam-1, Mam1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mVenus (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CMV ggtgggaggtctatataagc
- 3′ sequencing primer LTR rev ttgccaaacctacaggtgg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLPC-dnMAML1-mVenus was a gift from Masashi Narita (Addgene plasmid # 171023 ; http://n2t.net/addgene:171023 ; RRID:Addgene_171023) -
For your References section:
NOTCH1 mediates a switch between two distinct secretomes during senescence. Hoare M, Ito Y, Kang TW, Weekes MP, Matheson NJ, Patten DA, Shetty S, Parry AJ, Menon S, Salama R, Antrobus R, Tomimatsu K, Howat W, Lehner PJ, Zender L, Narita M. Nat Cell Biol. 2016 Sep;18(9):979-92. doi: 10.1038/ncb3397. Epub 2016 Aug 15. 10.1038/ncb3397 PubMed 27525720