pGal4x5-E4T-G210
(Plasmid
#171077)
-
PurposeThe resulting plasmid was used to generate a Gal4x5-E4-Gless 210bp construct for ampilifying the immobilized template for assays. Originally came from Michael Carey, was submitted with his permission
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171077 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEM-T
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGal4-E4-Gless-cassette
-
SpeciesS. cerevisiae (budding yeast), Synthetic
-
Insert Size (bp)95
- Promoter T7 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGal4x5-E4T-G210 was a gift from Joan Conaway (Addgene plasmid # 171077 ; http://n2t.net/addgene:171077 ; RRID:Addgene_171077) -
For your References section:
Elongin functions as a loading factor for Mediator at ATF6alpha-regulated ER stress response genes. He Y, Sato S, Tomomori-Sato C, Chen S, Goode ZH, Conaway JW, Conaway RC. Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118. 10.1073/pnas.2108751118 PubMed 34544872