Skip to main content

pETDuet-TFIIE
(Plasmid #171083)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171083 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pETDuet-1
  • Backbone size w/o insert (bp) 5336
  • Total vector size (bp) 7532
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    TF2E1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1320
  • GenBank ID
    NM_005513.2
  • Entrez Gene
    GTF2E1 (a.k.a. FE, TF2E1, TFIIE-A)
  • Promoter T7 promoter
  • Tag / Fusion Protein
    • His (N terminal on backbone)

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (destroyed during cloning)
  • 3′ cloning site SalI (destroyed during cloning)
  • 5′ sequencing primer ATGCGTCCGGCGTAGA
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TF2E2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    876
  • GenBank ID
    NM_002095.5
  • Entrez Gene
    GTF2E2 (a.k.a. FE, TF2E2, TFIIE-B, TTD6)
  • Promoter T7 promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer TTGTACACGGCCGCATAATC
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETDuet-TFIIE was a gift from Joan Conaway (Addgene plasmid # 171083 ; http://n2t.net/addgene:171083 ; RRID:Addgene_171083)
  • For your References section:

    Elongin functions as a loading factor for Mediator at ATF6alpha-regulated ER stress response genes. He Y, Sato S, Tomomori-Sato C, Chen S, Goode ZH, Conaway JW, Conaway RC. Proc Natl Acad Sci U S A. 2021 Sep 28;118(39):e2108751118. doi: 10.1073/pnas.2108751118. 10.1073/pnas.2108751118 PubMed 34544872