Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2)
(Plasmid #171102)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171102 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX458
  • Backbone manufacturer
    Feng Zhang (Addgene plasmid # 48138)
  • Vector type
    CRISPR
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hSpCas9
  • gRNA/shRNA sequence
    Otx2 gRNA1: CTTACCGGGGTAGCCCACGG; Otx2 gRNA2: CACCCCCCGGAAACAGCGAA
  • Species
    M. musculus (mouse); S. pyogenes
  • Entrez Gene
    Otx2 (a.k.a. E130306E05Rik)
  • Promoter Ef1a

Cloning Information

  • Cloning method Gateway Cloning

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX458-Ef1a-Cas9-H2B-mCherry (dual gRNA: Otx2 x2) was a gift from Joseph Brzezinski (Addgene plasmid # 171102 ; http://n2t.net/addgene:171102 ; RRID:Addgene_171102)
  • For your References section:

    Initiation of Otx2 expression in the developing mouse retina requires a unique enhancer and either Ascl1 or Neurog2 activity. Kaufman ML, Goodson NB, Park KU, Schwanke M, Office E, Schneider SR, Abraham J, Hensley A, Jones KL, Brzezinski JA. Development. 2021 Jun 15;148(12). pii: 269198. doi: 10.1242/dev.199399. Epub 2021 Jun 18. 10.1242/dev.199399 PubMed 34143204