pAAV gfaABC1D 2xLyn-ERex-Venus-bPAC(F198Y)
(Plasmid
#171117)
-
PurposeAstrocyte expression of PACmn, a photoactivatable adenylyl cyclase derived from bPAC, membrane-anchored, no/reduced dark activity
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171117 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5055
- Total vector size (bp) 6941
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name2xLyn-ERex-Venus-bPAC(F198Y)
-
Alt namePACmn
-
SpeciesSynthetic; Beggiatoa
-
Insert Size (bp)1885
- Promoter gfaABC1D
-
Tag
/ Fusion Protein
- Venus
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GTTGATTATCGATAAGCTTA
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert was assembled in the lab of Georg Nagel, the promotor is from Baljit Khakh
Addgene ID #52925
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV gfaABC1D 2xLyn-ERex-Venus-bPAC(F198Y) was a gift from Thomas Oertner (Addgene plasmid # 171117 ; http://n2t.net/addgene:171117 ; RRID:Addgene_171117) -
For your References section:
PACmn for improved optogenetic control of intracellular cAMP. Yang S, Constantin OM, Sachidanandan D, Hofmann H, Kunz TC, Kozjak-Pavlovic V, Oertner TG, Nagel G, Kittel RJ, Gee CE, Gao S. BMC Biol. 2021 Oct 18;19(1):227. doi: 10.1186/s12915-021-01151-9. 10.1186/s12915-021-01151-9 PubMed 34663304