pYeDP60-hATP13A2-WT
(Plasmid
#171377)
-
PurposeA modified pYEDP60 plasmid containing a yeast codon-optimized version of human ATP13A2 variant 2, followed by a thrombin cleavage site and a C-terminal BAD tag. DOI: 10.21769/BioProtoc.3888
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171377 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepYeDP60
-
Backbone manufacturerJoseph Lyons
- Backbone size w/o insert (bp) 9259
- Total vector size (bp) 13089
-
Modifications to backboneinsert of hATP13A2, thrombin cleavage site, BAD tag
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehuman ATP13A2 variant 2 wild-type
-
Alt namehATP13A2
-
Alt namepolyamine-transporting ATPase 13A2 isoform 2 [Homo sapiens]
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3830
-
GenBank IDNM_001141973.3
- Promoter URA3
-
Tag
/ Fusion Protein
- BAD tag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site ClaI (unknown if destroyed)
- 5′ sequencing primer TAACTTGGCCCACGCTGAAA
- 3′ sequencing primer CATGTTGGAATCTGTTCTTGATCAATGCCTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYeDP60-hATP13A2-WT was a gift from Peter Vangheluwe (Addgene plasmid # 171377 ; http://n2t.net/addgene:171377 ; RRID:Addgene_171377) -
For your References section:
ATP13A2 deficiency disrupts lysosomal polyamine export. van Veen S, Martin S, Van den Haute C, Benoy V, Lyons J, Vanhoutte R, Kahler JP, Decuypere JP, Gelders G, Lambie E, Zielich J, Swinnen JV, Annaert W, Agostinis P, Ghesquiere B, Verhelst S, Baekelandt V, Eggermont J, Vangheluwe P. Nature. 2020 Feb;578(7795):419-424. doi: 10.1038/s41586-020-1968-7. Epub 2020 Jan 29. 10.1038/s41586-020-1968-7 PubMed 31996848