Skip to main content

pX330A-Yap1-E2-#1
(Plasmid #171518)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171518 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    px330A
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Yap1
  • gRNA/shRNA sequence
    AGGGGGCCGGCGTCTTGTGC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Yap1 (a.k.a. Yap, Yap65, Yki, Yorkie)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330A-Yap1-E2-#1 was a gift from Hans Schöler (Addgene plasmid # 171518 ; http://n2t.net/addgene:171518 ; RRID:Addgene_171518)
  • For your References section:

    YAP establishes epiblast responsiveness to inductive signals for germ cell fate. Kagiwada S, Aramaki S, Wu G, Shin B, Kutejova E, Obridge D, Adachi K, Wrana JL, Hubner K, Scholer HR. Development. 2021 Oct 15;148(20). pii: 272520. doi: 10.1242/dev.199732. Epub 2021 Oct 19. 10.1242/dev.199732 PubMed 34528691