pX330A-Yap1-E2-#1
(Plasmid
#171518)
-
Purposedeletion of a genomic locus in Yap1 gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171518 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepx330A
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYap1
-
gRNA/shRNA sequenceAGGGGGCCGGCGTCTTGTGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneYap1 (a.k.a. Yap, Yap65, Yki, Yorkie)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330A-Yap1-E2-#1 was a gift from Hans Schöler (Addgene plasmid # 171518 ; http://n2t.net/addgene:171518 ; RRID:Addgene_171518) -
For your References section:
YAP establishes epiblast responsiveness to inductive signals for germ cell fate. Kagiwada S, Aramaki S, Wu G, Shin B, Kutejova E, Obridge D, Adachi K, Wrana JL, Hubner K, Scholer HR. Development. 2021 Oct 15;148(20). pii: 272520. doi: 10.1242/dev.199732. Epub 2021 Oct 19. 10.1242/dev.199732 PubMed 34528691