pLenti HsATP10B WT
(Plasmid
#171770)
-
Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B WT
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171770 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonelentiviral transferplasmid
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11402
- Total vector size (bp) 15803
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameATP10B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4386
-
MutationD433N
-
Entrez GeneATP10B (a.k.a. ATPVB)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti HsATP10B WT was a gift from Veerle Baekelandt (Addgene plasmid # 171770 ; http://n2t.net/addgene:171770 ; RRID:Addgene_171770) -
For your References section:
Mutated ATP10B increases Parkinson's disease risk by compromising lysosomal glucosylceramide export. Martin S, Smolders S, Van den Haute C, Heeman B, van Veen S, Crosiers D, Beletchi I, Verstraeten A, Gossye H, Gelders G, Pals P, Hamouda NN, Engelborghs S, Martin JJ, Eggermont J, De Deyn PP, Cras P, Baekelandt V, Vangheluwe P, Van Broeckhoven C. Acta Neuropathol. 2020 Jun;139(6):1001-1024. doi: 10.1007/s00401-020-02145-7. Epub 2020 Mar 14. 10.1007/s00401-020-02145-7 PubMed 32172343