pLenti TMEM30A
(Plasmid
#171789)
-
Purposetransfer plasmid for lentiviral vector production expressing TMEM30A
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171789 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiviral transferplasmid
-
Backbone manufacturerDidier Trono
- Backbone size w/o insert (bp) 11849
- Total vector size (bp) 13007
-
Vector typeLentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTMEM30A
-
SpeciesH. sapiens (human)
-
GenBank IDNM_018247
-
Entrez GeneTMEM30A (a.k.a. C6orf67, CDC50A)
- Promoter CMV
-
Tag
/ Fusion Protein
- 6X His + Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CAGACCTTGCATTCCTTTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti TMEM30A was a gift from Veerle Baekelandt (Addgene plasmid # 171789 ; http://n2t.net/addgene:171789 ; RRID:Addgene_171789) -
For your References section:
Mutated ATP10B increases Parkinson's disease risk by compromising lysosomal glucosylceramide export. Martin S, Smolders S, Van den Haute C, Heeman B, van Veen S, Crosiers D, Beletchi I, Verstraeten A, Gossye H, Gelders G, Pals P, Hamouda NN, Engelborghs S, Martin JJ, Eggermont J, De Deyn PP, Cras P, Baekelandt V, Vangheluwe P, Van Broeckhoven C. Acta Neuropathol. 2020 Jun;139(6):1001-1024. doi: 10.1007/s00401-020-02145-7. Epub 2020 Mar 14. 10.1007/s00401-020-02145-7 PubMed 32172343
