Skip to main content

114_UBI_iCre_crystGFP
(Plasmid #171797)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171797 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    1456-Cryst GFP pminTol2 R4-R2
  • Total vector size (bp) 10038

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    optimised iCre under the control of the Ubiquitin promoter
  • Insert Size (bp)
    1056
  • Promoter Ubiquitin

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACTGGCCGTCGTTTTACA
  • 3′ sequencing primer CAGGAAACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    114_UBI_iCre_crystGFP was a gift from Jean Giacomotto (Addgene plasmid # 171797 ; http://n2t.net/addgene:171797 ; RRID:Addgene_171797)
  • For your References section:

    Optimising the zebrafish Cre/Lox toolbox. Codon improved iCre, new gateway tools, Cre protein and guidelines. Tromp A, Wang H, Hall TE, Mowry B, Giacomotto J. Front Physiol. 2023 Aug 2;14:1221310. doi: 10.3389/fphys.2023.1221310. eCollection 2023. 10.3389/fphys.2023.1221310 PubMed 37601640