Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW57.1-FLAG-SRSF3_Truncated_Codon.Optimized-Blast
(Plasmid #171952)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171952 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCW57-MCS1-P2A-MCS2 (Blast)
  • Backbone size w/o insert (bp) 7446
  • Total vector size (bp) 7848
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    serine and arginine rich splicing factor 3
  • Alt name
    SRSF3 (codon-optimized, truncated)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    402
  • Mutation
    codon-optimized, truncated at amino acid 114 with a novel 10 amino acid C-terminal extension
  • GenBank ID
    NR_036610.2
  • Entrez Gene
    SRSF3 (a.k.a. SFRS3, SRp20)
  • Promoter TRE
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGTATGTCGAGGTAGGCGTG
  • 3′ sequencing primer AGGGCTGCCTTGGAAAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57.1-FLAG-SRSF3_Truncated_Codon.Optimized-Blast was a gift from Sujatha Jagannathan (Addgene plasmid # 171952 ; http://n2t.net/addgene:171952 ; RRID:Addgene_171952)
  • For your References section:

    Compromised nonsense-mediated RNA decay results in truncated RNA-binding protein production upon DUX4 expression. Campbell AE, Dyle MC, Albanese R, Matheny T, Sudheendran K, Cortazar MA, Forman T, Fu R, Gillen AE, Caruthers MH, Floor SN, Calviello L, Jagannathan S. Cell Rep. 2023 Jun 13;42(6):112642. doi: 10.1016/j.celrep.2023.112642. 10.1016/j.celrep.2023.112642 PubMed 37314931