pGEX2T-TUBG1
(Plasmid
#171967)
-
PurposepGEX2T-TUBG1 bacterial expression plasmid for production of recombinant GST fusion protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGEX2t
-
Backbone manufacturerAMRAD corparation limited
- Backbone size w/o insert (bp) 4900
- Total vector size (bp) 6247
-
Modifications to backboneSmaI site deleted
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsinduction with 0.22 mM IPTG for 1 h at 37 °ºC followed by overnight incubation at room temperature.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTUBG1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1347
-
MutationR275H (Please see depositor comments)
-
Entrez GeneTUBG1 (a.k.a. CDCBM4, GCP-1, TUBG, TUBGCP1)
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CCAAAATCGGATCTGGTTCC
- 3′ sequencing primer CAGATCGTCAGTCAGTCACG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTUBG1 was a gift from Jiri Bartek (Institute of Cancer Biology, Danish Cancer Society).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The TUBG1 gene from the plasmid obtained from Jiri Bartek was subcloned into pGEX2t. Addgene NGS found mutation R275H [NP_001061.2 ] but the depositor confirmed that this mutation does not affect function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX2T-TUBG1 was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 171967 ; http://n2t.net/addgene:171967 ; RRID:Addgene_171967) -
For your References section:
The gamma-tubulin meshwork assists in the recruitment of PCNA to chromatin in mammalian cells. Corvaisier M, Zhou J, Malycheva D, Cornella N, Chioureas D, Gustafsson NMS, Rossello CA, Ayora S, Li T, Ekstrom-Holka K, Jirstrom K, Lindstrom L, Alvarado-Kristensson M. Commun Biol. 2021 Jun 22;4(1):767. doi: 10.1038/s42003-021-02280-1. 10.1038/s42003-021-02280-1 PubMed 34158617