Skip to main content

pGEX2T-TUBG1
(Plasmid #171967)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 171967 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGEX2t
  • Backbone manufacturer
    AMRAD corparation limited
  • Backbone size w/o insert (bp) 4900
  • Total vector size (bp) 6247
  • Modifications to backbone
    SmaI site deleted
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    induction with 0.22 mM IPTG for 1 h at 37 °ºC followed by overnight incubation at room temperature.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    TUBG1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1347
  • Mutation
    R275H (Please see depositor comments)
  • Entrez Gene
    TUBG1 (a.k.a. CDCBM4, GCP-1, TUBG, TUBGCP1)
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SmaI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CCAAAATCGGATCTGGTTCC
  • 3′ sequencing primer CAGATCGTCAGTCAGTCACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TUBG1 was a gift from Jiri Bartek (Institute of Cancer Biology, Danish Cancer Society).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The TUBG1 gene from the plasmid obtained from Jiri Bartek was subcloned into pGEX2t. Addgene NGS found mutation R275H [NP_001061.2 ] but the depositor confirmed that this mutation does not affect function

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX2T-TUBG1 was a gift from Maria Alvarado-Kristensson (Addgene plasmid # 171967 ; http://n2t.net/addgene:171967 ; RRID:Addgene_171967)
  • For your References section:

    The gamma-tubulin meshwork assists in the recruitment of PCNA to chromatin in mammalian cells. Corvaisier M, Zhou J, Malycheva D, Cornella N, Chioureas D, Gustafsson NMS, Rossello CA, Ayora S, Li T, Ekstrom-Holka K, Jirstrom K, Lindstrom L, Alvarado-Kristensson M. Commun Biol. 2021 Jun 22;4(1):767. doi: 10.1038/s42003-021-02280-1. 10.1038/s42003-021-02280-1 PubMed 34158617