pACUH-GFP1-10 sec
(Plasmid
#172062)
-
PurposeUAS vector to express GFP1-10 in the ER lumen
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172062 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepACUH
-
Backbone manufacturerYuh-Nung Jan
- Backbone size w/o insert (bp) 9336
- Total vector size (bp) 10049
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP1-10 sec
-
SpeciesD. melanogaster (fly)
-
Insert Size (bp)708
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAACCAGCAACCAAGTAAAT
- 3′ sequencing primer GCTTTAAATCTCTGTAGGTAGTTTGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACUH-GFP1-10 sec was a gift from Daichi Kamiyama (Addgene plasmid # 172062 ; http://n2t.net/addgene:172062 ; RRID:Addgene_172062) -
For your References section:
Cell-type-specific, multicolor labeling of endogenous proteins with split fluorescent protein tags in Drosophila. Kamiyama R, Banzai K, Liu P, Marar A, Tamura R, Jiang F, Fitch MA, Xie J, Kamiyama D. Proc Natl Acad Sci U S A. 2021 Jun 8;118(23). pii: 2024690118. doi: 10.1073/pnas.2024690118. 10.1073/pnas.2024690118 PubMed 34074768