pET28a-Gluc-EL222-his
(Plasmid
#172097)
-
PurposeExpresses the fusion protein of Gluc and the light-activated transcription factor EL222 in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET28a
- Backbone size w/o insert (bp) 5274
- Total vector size (bp) 6507
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositor recommends using SHuffle T7 E. coli for correct folding of the protein during expression (due to multiple disulfide bonds)
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGaussia Luciferase - EL222
-
Alt nameGluc-EL222
-
SpeciesSynthetic
-
Insert Size (bp)1233
-
MutationGluc mutations - M43L, M110L
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET28a-Gluc-EL222-his was a gift from Avi Schroeder (Addgene plasmid # 172097 ; http://n2t.net/addgene:172097 ; RRID:Addgene_172097) -
For your References section:
Synthetic cells with self-activating optogenetic proteins communicate with natural cells. Adir O, Albalak MR, Abel R, Weiss LE, Chen G, Gruber A, Staufer O, Kurman Y, Kaminer I, Shklover J, Shainsky-Roitman J, Platzman I, Gepstein L, Shechtman Y, Horwitz BA, Schroeder A. Nat Commun. 2022 Apr 28;13(1):2328. doi: 10.1038/s41467-022-29871-8. 10.1038/s41467-022-29871-8 PubMed 35484097