Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pAAV-pCaMKII-EBFP-tTAn
(Plasmid #172124)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172124 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV-EF1a-DIO-TVA950-T2A-CVS14G-WPRE
  • Backbone size w/o insert (bp) 4039
  • Vector type
    AAV
  • Selectable markers
    EBFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pCaMKII, EBFP, tTAn-InteinN
  • Species
    Synthetic
  • Insert Size (bp)
    3013
  • Promoter EF1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gggaaacgcctggtatcttt
  • 3′ sequencing primer gcgtaaaaggagcaacatag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pCaMKII from pLenti-CaMKIIa-VChR1-EYFP-WPRE(Addgene #20954), EBFP from AAV pmSyn1-EBFP-Cre(Addgene #51507), tTAN from pAAV-TRE-fDIO-GFP-IRES-tTA, InteinN from pLKO-GFP-IntN-ddFKBP (An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function. Deng Pan, et al. Sci Rep, 2016. 6: p. 26167.)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Used Infusion cloning. 5' cloning site: XbaI (not destroyed), 3' cloning site: EcoRV (not destroyed). Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438407v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-pCaMKII-EBFP-tTAn was a gift from Chun Xu (Addgene plasmid # 172124 ; http://n2t.net/addgene:172124 ; RRID:Addgene_172124)
  • For your References section:

    An intein-split transactivator for intersectional neural imaging and optogenetic manipulation. Chen HS, Zhang XL, Yang RR, Wang GL, Zhu XY, Xu YF, Wang DY, Zhang N, Qiu S, Zhan LJ, Shen ZM, Xu XH, Long G, Xu C. Nat Commun. 2022 Jun 23;13(1):3605. doi: 10.1038/s41467-022-31255-x. 10.1038/s41467-022-31255-x PubMed 35739125