pAAV-pEF1a-DIO-tTAc
(Plasmid
#172126)
-
PurposeExpression of InteinC-tTAC in Cre recombinase positive cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172126 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-EF1a-DIO-TVA950-T2A-CVS16G-WPRE
- Backbone size w/o insert (bp) 5590
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInteinC-tTAc
-
SpeciesSynthetic
-
Insert Size (bp)268
- Promoter CaMKII
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ggcacttgatgtaattctcc
- 3′ sequencing primer gcgtaaaaggagcaacatag
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bytTAC from pAAV-TRE-fDIO-GFP-IRES-tTA(Addgene #118026), InteinC from pLKO-IntC-Flag (An intein-mediated modulation of protein stability system and its application to study human cytomegalovirus essential gene function. Deng Pan, et al. Sci Rep, 2016. 6: p. 26167.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Used Infusion cloning. 5' cloning site: AscI (not destroyed), 3' cloning site: NheI (not destroyed). Please visit https://www.biorxiv.org/content/10.1101/2021.04.05.438407v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-pEF1a-DIO-tTAc was a gift from Chun Xu (Addgene plasmid # 172126 ; http://n2t.net/addgene:172126 ; RRID:Addgene_172126) -
For your References section:
An intein-split transactivator for intersectional neural imaging and optogenetic manipulation. Chen HS, Zhang XL, Yang RR, Wang GL, Zhu XY, Xu YF, Wang DY, Zhang N, Qiu S, Zhan LJ, Shen ZM, Xu XH, Long G, Xu C. Nat Commun. 2022 Jun 23;13(1):3605. doi: 10.1038/s41467-022-31255-x. 10.1038/s41467-022-31255-x PubMed 35739125