pET-21a(+)-BMTU UDG-6xHis
(Plasmid
#172197)
-
Purposeexpresses His-tagged uracil-DNA-glycosylase enzyme from marine bacterium BMTU 3346 for the purpose of cross contamination prevention in nucleic acid amplification reactions
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET-21(+)
-
Backbone manufacturerEMD Bioscience
- Backbone size w/o insert (bp) 5443
- Total vector size (bp) 5996
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBMTU UDG
-
Alt nameBMTU 3346 UDG
-
Alt nameUNG
-
Alt nameuracil-DNA-glycosylase
-
Speciesmarine bacterium BMTU 3346 UDG
-
Insert Size (bp)745
- Promoter T7
-
Tag
/ Fusion Protein
- 6xHis tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
E. coli codon-optimised variant of BMTU 3346 UDG gene originally published in:
Jaeger, S., Schmuck, R., & Sobek, H. (2000). Molecular cloning, sequency, and expression of the heat-labile uracil-DNA glycosylase from a marine psychrophilic bacterium, strain BMTU3346. Extremophiles : life under extreme conditions, 4(2), 115–122. https://doi.org/10.1007/s007920050145
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-21a(+)-BMTU UDG-6xHis was a gift from Andrea Pauli (Addgene plasmid # 172197 ; http://n2t.net/addgene:172197 ; RRID:Addgene_172197)