Skip to main content
Addgene

phOCT4-Luc
(Plasmid #17221)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 17221 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGV-BM2
  • Backbone size w/o insert (bp) 4842
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Upstream region of human OCT4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5068
  • Entrez Gene
    POU5F1 (a.k.a. OCT3, OCT4, OCT4Borf1, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer RVprimer3 (CTAGCAAAATAGGCTGTCCC)
  • 3′ sequencing primer LucNRev (CCTTATGCAGTTGCTCTCC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phOCT4-Luc was a gift from Shinya Yamanaka (Addgene plasmid # 17221 ; http://n2t.net/addgene:17221 ; RRID:Addgene_17221)
  • For your References section:

    Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Cell. 2007 Nov 30. 131(5):861-72. 10.1016/j.cell.2007.11.019 PubMed 18035408