Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

2X_pX458_pSpCas9(BB)-2A-GFP_NANOG_bKO
(Plasmid #172224)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172224 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    2X_pX458_pSpCas9(BB)-2A-GFP (Plasmid #172221)
  • Backbone manufacturer
    Alexander Meissner
  • Backbone size w/o insert (bp) 9699
  • Total vector size (bp) 9703
  • Modifications to backbone
    Two sgRNAs targeting the telomeric human NANOG CTCF-boundary are cloned into the BbsI (not restored) and SapI (not restored) site.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    sgRNA
  • gRNA/shRNA sequence
    CATCCTTTGATACACCCCCT, TGTTAGTCTTTGTTCAACCG
  • Species
    H. sapiens (human)
  • GenBank ID
    hg19, chr12:7958377-7958396 hg19, chr12:7960486-7960505
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3XFLAG (N terminal on insert)
    • GFP (C terminal on insert)

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    2X_pX458_pSpCas9(BB)-2A-GFP_NANOG_bKO was a gift from Alexander Meissner (Addgene plasmid # 172224 ; http://n2t.net/addgene:172224 ; RRID:Addgene_172224)
  • For your References section:

    Topological isolation of developmental regulators in mammalian genomes. Wu HJ, Landshammer A, Stamenova EK, Bolondi A, Kretzmer H, Meissner A, Michor F. Nat Commun. 2021 Aug 12;12(1):4897. doi: 10.1038/s41467-021-24951-7. 10.1038/s41467-021-24951-7 PubMed 34385432