pCDH_ss-SBP-EGFP
(Plasmid
#172358)
-
PurposeReporter to monitoring a streptavidin-binding peptide trafficking
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 172358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCDH-CMV-MCS-hygro
-
Backbone manufacturersystem biosciences
- Backbone size w/o insert (bp) 8729
- Total vector size (bp) 8783
-
Modifications to backbonepCDH was modified to remove the EF1 promoter and the puromycin resistance cassette driven by EF1 promoter. An IRES and a hygromycin resistance cassette were introduced downstream of SBP-EGFP.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameER importing signal sequence
-
Alt namess
-
SpeciesH. sapiens (human)
-
Insert Size (bp)54
- Promoter CMV
-
Tag
/ Fusion Protein
- SBP-EGFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AAATGTCGTAACAACTCCGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
It has to be used in combinaison with pCDH_Str-KDEL_neomycin (ID 65307) to mimic the conventional protein secretion
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH_ss-SBP-EGFP was a gift from Guido Kroemer (Addgene plasmid # 172358 ; http://n2t.net/addgene:172358 ; RRID:Addgene_172358) -
For your References section:
Identification of pharmacological inhibitors of conventional protein secretion. Zhao L, Liu P, Boncompain G, Loos F, Lachkar S, Bezu L, Chen G, Zhou H, Perez F, Kepp O, Kroemer G. Sci Rep. 2018 Oct 8;8(1):14966. doi: 10.1038/s41598-018-33378-y. 10.1038/s41598-018-33378-y PubMed 30297865