pGal-BE3
(Plasmid
#172409)
-
PurposeYeast plasmid encoding the third-generation CRISPR base editor BE3 (Komor et al., Nature 2016) under a galactose-inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172409 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep415-GALL
-
Backbone manufacturerMumberg et al. (Nucleic Acids Research, 1994, Vol. 22, No. 25)
- Backbone size w/o insert (bp) 6653
- Total vector size (bp) 11786
-
Vector typeYeast Expression, CRISPR
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBE3
-
Alt nameThird generation CRISPR base editor
-
SpeciesSynthetic
-
Insert Size (bp)5133
- Promoter GALL
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATTAACCCTCACTAAAG
- 3′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byInsert (BE3) from pCMV-BE3 (Addgene #73021); backbone (p415-GALL) from p415-GalL-Cas9-CYC1t (Addgene #43804)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGal-BE3 was a gift from Leonid Kruglyak (Addgene plasmid # 172409 ; http://n2t.net/addgene:172409 ; RRID:Addgene_172409) -
For your References section:
Genome-wide base editor screen identifies regulators of protein abundance in yeast. Schubert OT, Bloom JS, Sadhu MJ, Kruglyak L. Elife. 2022 Nov 3;11. pii: 79525. doi: 10.7554/eLife.79525. 10.7554/eLife.79525 PubMed 36326816