Skip to main content

pLV_PP1-mCitrine
(Plasmid #172472)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172472 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti 2nd gen
  • Backbone size w/o insert (bp) 8740
  • Total vector size (bp) 10609
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    prolactinSS-PP1-mCitrine
  • Alt name
    zebrafish parapinopsina (PP1)
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1869
  • Entrez Gene
    parapinopsina (a.k.a. pp1, uvpp)
  • Promoter EF1alpha
  • Tags / Fusion Proteins
    • mCitrine (C terminal on insert)
    • prolactin signal sequence (cleaved post-translationally) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggagtacgtcgtctttaggt
  • 3′ sequencing primer cgtcttttggcaatgtgagg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_PP1-mCitrine was a gift from Sean R Collins (Addgene plasmid # 172472 ; http://n2t.net/addgene:172472 ; RRID:Addgene_172472)
  • For your References section:

    Optogenetic control of receptors reveals distinct roles for actin- and Cdc42-dependent negative signals in chemotactic signal processing. Bell GRR, Rincon E, Akdogan E, Collins SR. Nat Commun. 2021 Nov 16;12(1):6148. doi: 10.1038/s41467-021-26371-z. 10.1038/s41467-021-26371-z PubMed 34785668