pLV_iRFP_P2AT2A_mScarlet-I_Myl9
(Plasmid
#172474)
-
PurposeMammalian expression of myosin light chain (Myl9) tagged with mScarlet-I and cytoplasmic iRFP as a reference marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172474 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti 2nd gen
- Backbone size w/o insert (bp) 9227
- Total vector size (bp) 11550
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameiRFP670
-
Alt nameiRFP
-
SpeciesSynthetic
-
Insert Size (bp)933
-
GenBank ID
- Promoter EF1alpha (with UCOE)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer ggagtacgtcgtctttaggt
- 3′ sequencing primer aggaccgggattttcttcc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namemScarlet-I-Myl9
-
Alt nameMYL9
-
Alt namemyosin light chain
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1221
-
GenBank IDNM_006097
- Promoter none (same transcript as insert 1, separated by P2A-T2A element)
-
Tag
/ Fusion Protein
- mScarlet-I (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGCAGAGGAAGTCTGC
- 3′ sequencing primer cgtcttttggcaatgtgagg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMYL9 was a gift from Arnold Hayer. The iRFP670 was created by Vladislav Verkhusha's lab (Addgene #45466). The UCOE sequence was a gift from Jonathan Weissman's lab.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_iRFP_P2AT2A_mScarlet-I_Myl9 was a gift from Sean R Collins (Addgene plasmid # 172474 ; http://n2t.net/addgene:172474 ; RRID:Addgene_172474) -
For your References section:
Directional reorientation of migrating neutrophils is limited by suppression of receptor input signaling at the cell rear through myosin II activity. Hadjitheodorou A, Bell GRR, Ellett F, Shastry S, Irimia D, Collins SR, Theriot JA. Nat Commun. 2021 Nov 16;12(1):6619. doi: 10.1038/s41467-021-26622-z. 10.1038/s41467-021-26622-z PubMed 34785640