Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLV_iRFP_P2AT2A_mScarlet-I_Myl9
(Plasmid #172474)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172474 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti 2nd gen
  • Backbone size w/o insert (bp) 9227
  • Total vector size (bp) 11550
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    iRFP670
  • Alt name
    iRFP
  • Species
    Synthetic
  • Insert Size (bp)
    933
  • GenBank ID
  • Promoter EF1alpha (with UCOE)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ggagtacgtcgtctttaggt
  • 3′ sequencing primer aggaccgggattttcttcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    mScarlet-I-Myl9
  • Alt name
    MYL9
  • Alt name
    myosin light chain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1221
  • GenBank ID
    NM_006097
  • Promoter none (same transcript as insert 1, separated by P2A-T2A element)
  • Tag / Fusion Protein
    • mScarlet-I (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGGGCAGAGGAAGTCTGC
  • 3′ sequencing primer cgtcttttggcaatgtgagg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    MYL9 was a gift from Arnold Hayer. The iRFP670 was created by Vladislav Verkhusha's lab (Addgene #45466). The UCOE sequence was a gift from Jonathan Weissman's lab.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_iRFP_P2AT2A_mScarlet-I_Myl9 was a gift from Sean R Collins (Addgene plasmid # 172474 ; http://n2t.net/addgene:172474 ; RRID:Addgene_172474)
  • For your References section:

    Directional reorientation of migrating neutrophils is limited by suppression of receptor input signaling at the cell rear through myosin II activity. Hadjitheodorou A, Bell GRR, Ellett F, Shastry S, Irimia D, Collins SR, Theriot JA. Nat Commun. 2021 Nov 16;12(1):6619. doi: 10.1038/s41467-021-26622-z. 10.1038/s41467-021-26622-z PubMed 34785640