BW-Para
(Bacterial strain #172602)

• Purpose: The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays.
• Depositing Lab: Liskin Swint-Kruse
• Publication: Picard et al Proteins. 2021 Aug 8. doi: 10.1002/prot.26206.

Backbone

• Vector backbone: n/a

Growth in Bacteria

• Bacterial Resistance(s): None
• Growth Temperature: 37°C
• Growth Strain(s): BW-Para
• Copy number: Unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The BW-Para E. coli strain is used to screen the functions of chimeric AraC/XylS transcription activators using beta-galactosidase assays (after growing transformed cells on MOPS media). Plasmids encoding these chimeras are found at https://www.addgene.org/browse/article/28216962/.  The protocol for the reporter assay is detailed in the manuscript. The genotype for BW-Para is [F-, Δ(araD-araB)567, ΔlacZ4787(::rrnB-3), λ-, rph-1, Δ(rhaD-rhaB)568, hsdR514], ΔlacI785::kan, ΔaraC771::kan, ΔrhaSR::(PBADmut:lacZ)].  The PBADmut:lacZ reporter construct integrated into the rhaSR KO locus comprises a synthetic Para-I promoter with -10/-35 sites of GATACT/TTTACA respectively and an ara-I DNA binding site proximal to the -35 site.  The integrated 3.5 kb cassette coding for the reporter construct can be amplified from the genome using the primers: (forward) 5' - GGTGAAAGTTGGAACCTCTTAC - 3' and (reverse) 5'- GCGAGGAAGCGGAATATATCCCC - 3'. Cells should be freshly transformed prior to each assay.