Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

px458-CCND1
(Plasmid #172630)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172630 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    px458
  • Backbone manufacturer
    F. Zhang (Addgene plasmid #48138)
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gRNA against CCND1
  • Alt name
    cyclin D1
  • Alt name
    BCL1
  • gRNA/shRNA sequence
    CGCGTACCCCGATGCCAACC
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    20
  • Entrez Gene
    CCND1 (a.k.a. BCL1, D11S287E, PRAD1, U21B31)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px458-CCND1 was a gift from Michele Pagano (Addgene plasmid # 172630 ; http://n2t.net/addgene:172630 ; RRID:Addgene_172630)
  • For your References section:

    CRL4(AMBRA1) is a master regulator of D-type cyclins. Simoneschi D, Rona G, Zhou N, Jeong YT, Jiang S, Milletti G, Arbini AA, O'Sullivan A, Wang AA, Nithikasem S, Keegan S, Siu Y, Cianfanelli V, Maiani E, Nazio F, Cecconi F, Boccalatte F, Fenyo D, Jones DR, Busino L, Pagano M. Nature. 2021 Apr;592(7856):789-793. doi: 10.1038/s41586-021-03445-y. Epub 2021 Apr 14. 10.1038/s41586-021-03445-y PubMed 33854235