Skip to main content

pMSCV-FLAG-2xSTREP-CCND1(P287A)-Puro
(Plasmid #172641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 172641 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMSCV-Puro
  • Backbone manufacturer
    Takara Bio
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CCND1
  • Alt name
    cyclin D1
  • Alt name
    BCL1
  • Species
    H. sapiens (human)
  • Mutation
    Pro287Ala
  • Entrez Gene
    CCND1 (a.k.a. BCL1, D11S287E, PRAD1, U21B31)
  • Tag / Fusion Protein
    • FLAG-2xSTREP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer CCCTTGAACCTCCTCGTTCGACC
  • 3′ sequencing primer GAGACGTGCTACTTCCATTTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMSCV-FLAG-2xSTREP-CCND1(P287A)-Puro was a gift from Michele Pagano (Addgene plasmid # 172641 ; http://n2t.net/addgene:172641 ; RRID:Addgene_172641)
  • For your References section:

    CRL4(AMBRA1) is a master regulator of D-type cyclins. Simoneschi D, Rona G, Zhou N, Jeong YT, Jiang S, Milletti G, Arbini AA, O'Sullivan A, Wang AA, Nithikasem S, Keegan S, Siu Y, Cianfanelli V, Maiani E, Nazio F, Cecconi F, Boccalatte F, Fenyo D, Jones DR, Busino L, Pagano M. Nature. 2021 Apr;592(7856):789-793. doi: 10.1038/s41586-021-03445-y. Epub 2021 Apr 14. 10.1038/s41586-021-03445-y PubMed 33854235