Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

PB-HD252
(Plasmid #172656)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 172656 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    piggyBAC-U6-BlastR
  • Vector type
    CRISPR
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    pegRNA-HD252A/pegRNA-HD252B
  • gRNA/shRNA sequence
    unspecified
  • Species
    Synthetic

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PB-HD252 was a gift from Jay Shendure (Addgene plasmid # 172656 ; http://n2t.net/addgene:172656 ; RRID:Addgene_172656)
  • For your References section:

    Precise genomic deletions using paired prime editing. Choi J, Chen W, Suiter CC, Lee C, Chardon FM, Yang W, Leith A, Daza RM, Martin B, Shendure J. Nat Biotechnol. 2021 Oct 14. pii: 10.1038/s41587-021-01025-z. doi: 10.1038/s41587-021-01025-z. 10.1038/s41587-021-01025-z PubMed 34650269