-
PurposeDelivery of guide RNA for prime editing
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 172717 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepVRb
- Backbone size w/o insert (bp) 3777
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameJ23119-gRNA
-
gRNA/shRNA sequencescaffold: GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGC
-
SpeciesSynthetic
-
Insert Size (bp)111
Cloning Information
- Cloning method Gibson Cloning
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.279141v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pnsgRNA was a gift from Tilmann Weber (Addgene plasmid # 172717 ; http://n2t.net/addgene:172717 ; RRID:Addgene_172717) -
For your References section:
A versatile genetic engineering toolkit for E. coli based on CRISPR-prime editing. Tong Y, Jorgensen TS, Whitford CM, Weber T, Lee SY. Nat Commun. 2021 Sep 1;12(1):5206. doi: 10.1038/s41467-021-25541-3. 10.1038/s41467-021-25541-3 PubMed 34471126