-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 17286 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneAdenoviral Recombinant (pAdEasy)
- Backbone size w/o insert (bp) 33400
-
Vector typeMammalian Expression, Adenoviral
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePV-NES
-
Alt namePV-NES-DsRed-myc
-
Alt nameParvalbumin
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1100
-
GenBank IDM12725
-
Entrez GenePvalb (a.k.a. PALB1, Pva)
-
Tags
/ Fusion Proteins
- DSR (C terminal on insert)
- Myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GTGGCAAAAGTGACGTTTTTGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
AdEasy is a registered trademark of the Johns Hopkins University.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAd-PV-NES-DsRed was a gift from Anton Bennett (Addgene plasmid # 17286 ; http://n2t.net/addgene:17286 ; RRID:Addgene_17286) -
For your References section:
Nucleoplasmic calcium is required for cell proliferation. Rodrigues MA, Gomes DA, Leite MF, Grant W, Zhang L, Lam W, Cheng YC, Bennett AM, Nathanson MH. J Biol Chem. 2007 Jun 8. 282(23):17061-8. 10.1074/jbc.M700490200 PubMed 17420246