TfR-moxGFP-DHFR
(Plasmid
#173012)
-
PurposeFor light regulated release of transferrin receptor (TfR) from the endoplasmic reticulum. Driven by CMV promoter. Fused to oxidation resistant version of GFP (moxGFP).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173012 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJPA
- Backbone size w/o insert (bp) 4721
- Total vector size (bp) 8240
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTfR-moxGFP-DHFR
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3519
- Promoter CMV
-
Tags
/ Fusion Proteins
- moxGFP (C terminal on insert)
- DHFR (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer CCTTTCTCTCCACAGGTGTC
- 3′ sequencing primer TGCAATAAACAAGTTGGGCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTfR ORF was a gift from Dr. Michael Ehlers; mox-GFP was a gift from Dr. Erik Snapp, Addgene plasmid#68070
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.278770v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TfR-moxGFP-DHFR was a gift from Matthew Kennedy (Addgene plasmid # 173012 ; http://n2t.net/addgene:173012 ; RRID:Addgene_173012) -
For your References section:
zapERtrap: A light-regulated ER release system reveals unexpected neuronal trafficking pathways. Bourke AM, Schwartz SL, Bowen AB, Kleinjan MS, Winborn CS, Kareemo DJ, Gutnick A, Schwarz TL, Kennedy MJ. J Cell Biol. 2021 Sep 6;220(9). pii: 212461. doi: 10.1083/jcb.202103186. Epub 2021 Jul 9. 10.1083/jcb.202103186 PubMed 34241635