Skip to main content

TfR-moxGFP-DHFR
(Plasmid #173012)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 173012 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJPA
  • Backbone size w/o insert (bp) 4721
  • Total vector size (bp) 8240
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TfR-moxGFP-DHFR
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3519
  • Promoter CMV
  • Tags / Fusion Proteins
    • moxGFP (C terminal on insert)
    • DHFR (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer CCTTTCTCTCCACAGGTGTC
  • 3′ sequencing primer TGCAATAAACAAGTTGGGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    TfR ORF was a gift from Dr. Michael Ehlers; mox-GFP was a gift from Dr. Erik Snapp, Addgene plasmid#68070

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TfR-moxGFP-DHFR was a gift from Matthew Kennedy (Addgene plasmid # 173012 ; http://n2t.net/addgene:173012 ; RRID:Addgene_173012)
  • For your References section:

    zapERtrap: A light-regulated ER release system reveals unexpected neuronal trafficking pathways. Bourke AM, Schwartz SL, Bowen AB, Kleinjan MS, Winborn CS, Kareemo DJ, Gutnick A, Schwarz TL, Kennedy MJ. J Cell Biol. 2021 Sep 6;220(9). pii: 212461. doi: 10.1083/jcb.202103186. Epub 2021 Jul 9. 10.1083/jcb.202103186 PubMed 34241635